>snap_masked-scaffold12685-abinit-gene-0.2-mRNA-1
ATGGAATCTTCAAAGAAGAGGAAGAGTAGAGGTGATGGAGTGTCTGTGGCTGAGACATTG
GCCAGGTGGAGAGACTATGGGGTCGAGCCGTCGAGGAAGGGATGTATGAAAGGAAAAGGA
GGGCCTGAGAATGCACTCTGCAATTACAGAGGGGTTAGGCAAAGGACCTGGGGTAAATGG
GTTGCGGAGATTCGTGAGCCTAACGGAGGAAAGAGACTTTGGCTTGGCACTCTCGATAAT
GCTGTTGATGCTGCTTCTGCTTACGATGAAGCTGCTAGGGTGATGTATGGAGCCTATGCG
CGACTCAATTTCCCGGAGTCTGTTTCCACTATATCTGGCCCTAGTCCTGTGGAATCTGAG
GTTTCTGCTGTTGAATCTACTGCCATGGCTAGTACAAGTGAGTCTACTGCCATGCCAACT
ACAAGTAGTTTGGTGCAGGATGAGTCTGGTGTAACGAGCTACTCTATGGATAGTGGACTG
GACCAATATCTGGATTGTTCTGAAAACGAACTTTTTAATGTGCAAGAACTTATGGCACTA
TTAGACAGTGACCCTGTTGGCTTCACAGATTCAGAAGTGGGTTTTGATTATTATGGTGAT
CAATTCGGAATGCCGTCCAAGTAG