>maker-scaffold01061-augustus-gene-0.28-mRNA-1
AAGCCCAAAGCCAAGGCTAAGCGAGCTAAGAAAACTCACAACCCAGAGAAATGCCTGAAT
GGCAACTCAGCTGGCTCGGCTAGGAGAAGCTCAATTTACAGAGGAGTCACAAGGCACAGA
TGGACTGGGAGATATGAAGCTCACCTTTGGGACAAGAGTTCCTGGAATAACATTCAGAAC
AAGAAAGGACGACAAGGGGCATATGATAATGAAGAGGCTGCTGCTCATACTTATGACCTT
GCTGCCCTTAAGTATTGGGGCCCTGGTACAACCTTGAATTTCCCGATAGAGACTTATACA
AAGGAACTTGAGGAAATGCAAAAGGTTACTAAGGAAGAATACTTGGCCTCATTGCGAAGA
AGGAGCTCTGGATTTTCTAGAGGAGTGTCTAAGTATCGTGGGGTGGCGAGGCATCACCAT
AATGGGCGTTGGGAAGCAAGAATTGGAAGAGTTTTTGGCAACAAATACCTGTACCTGGGA
ACTTACAACACACAGGAAGAAGCAGCAGCAGCTTATGACATGGCAGCGATAGAGTACAGA
GGAGCAAATGCTGTGACTAATTTTGACATCAGTAATTATATTGACCGCATGAAGAAGAAA
ATCCCTGGCTTTAATGCCCAAAGTTCTACTCAATCAGATGCAGCACTTCCCAACAATTGC
CAGCCTCAATCAAAAGTAGAAGTGGACAATTGCCAGCCTCAATCAAAAGTAGAAGTGGCA
GTAGAGCAATTACAACAACAAAAGCAAGAAAAACAAGAAGTGGGATTAGAAGAACAGCTT
CAATATAATATCAGTACACAGCTCCCTCCTTGCATGGACACAACTTCTACAATGGTGGGA
ATGGAGCCTTCTAGGGAGCAAGAAGAAGACCCTTGGAGCTTTTTGGACAATGTTCCTGAC
CTCCCCATTGAAAAGCCATGCGAGTTAAATGACCTGTTTGATCACACTGGATTTGAGGAT
GACATTGATTTTATATTTGAAGCAGCGGCAGCAGCAGCTGTGACACACCAAGATGTTGTT
GATGTCAAAATGGATGGCATTTTGGATGACATTTCAGGTTTTGATGACACTCTCAAGGTT
GTTGGTGTGTCAAGGAGCTTGGACAATATAATTGGGCAGGAGAGGCTGTTGTCTTCTTCT
TCTTCTTCTTCTTCTTCTGCTATTTCTTCTCCATCTTCTTCTACTACAACCTCGGTTTCT
TGTATCTATTCTGCTTGA