>augustus_masked-scaffold07258-abinit-gene-0.0-mRNA-1
ATGGAGAAGCACAAGTGTAAACTATGCTTGAGGAGCTTCTCTAATGGTAGAGCTTTGGGG
GGTCACATGAGGTCTCACATGTTGAATCTTCCAATTGTTCAAAAGCCAGAATCACCACCA
CCACCACCACCACTACCACCGCCACCGCCACTACAACCACAACCACAACCACAACAGCCA
CCACACAACCAACTCAGTGGGACTCTGTCAGCTTCTTTTTCATCTTCATCTTCTTCGGAA
GATGATGATGATGATGAGAAGGGTATCTATGGGCTAAGAGAGAACCCAAAGAGAAGCATT
CGTTTGGTAGATCCTGAATTCGTTGATGGTGGGTCTGTGGTTCTTCCAGACAGAGAGAGC
GAGACAGAGTCTTCGAAGAACCCAACTCGGAAACGATCCAAGAGGACTCGGACTTTGGAC
CAAACCTTCCACCATCAGTACCATCACCACAGAATTCAAGAACAAGCTGAGGCCATGAAG
AAGCATCCGAAATTCAAGTACAAAGCTGTTGCTGCTGATCAATCCTCATGGGCTGAGCCT
GAGCCTGAGCCAGTGAGTTCGATCTCCGATACCACTCAAGAAGAGCATGTTGCCTTTTGC
CTCATGATGCTTTCAAGAGACAAATGGAAGAAACAAGAACAACAACAACAACCACAGGGT
AACAACGAAGAAGACAACGAAGATGATGATGTTGACGAAGACGAGGACGAAGAAGACGAA
GAAGAAGAAGAAGAAGAAGAACAAGAGCAAGAACAAGAAGAAGAAGATGAAGCTGTGGAG
AGCGATGAGTCCGAGGAGCTGATCAAATTGTCAAAGACAACTACTCGAACGCGTGGCAAA
TTCAAGTGCGAGACTTGTAAGAAAACTTTTCGATCTTATCAAGCACTAGGTGGACACAGA
GCGAGTCACAAGAAGATCAAGTTGCTTTCTAGTACTACAACTCCAGCTAATAATTATGAG
CCCAAATTGGAGCACCGAAATGTGGGTACTCCAGAGAAAAAGATTCATGAATGCCCAGTT
TGTTTTAGAGTGTTCTCGTCAGGACAAGCTCTGGGTGGACACAAGAGAACCCATGTAACT
GGTTCAACTTCAGCACCAACTTCTGCTAGAGCTTCAACCAAGCTTGGACAAGCTTTGATA
GATCTTAATCTTCCAGCTCCAATGGAGGATGATGACATTAGTCAAGTTTCTGATGCAGAA
TTTGTGAACCCCTTTAGGCGATGA